Coding
Part:BBa_K4769221:Design
Designed by: Kieran Abbott Group: iGEM23_Cambridge (2023-10-10)
Porphyran utilisation locus fragment 4
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 815
Illegal EcoRI site found at 869
Illegal EcoRI site found at 1646 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 815
Illegal EcoRI site found at 869
Illegal EcoRI site found at 1646 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 815
Illegal EcoRI site found at 869
Illegal EcoRI site found at 1646
Illegal XhoI site found at 836 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 815
Illegal EcoRI site found at 869
Illegal EcoRI site found at 1646 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 815
Illegal EcoRI site found at 869
Illegal EcoRI site found at 1646
Illegal AgeI site found at 6160 - 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI site found at 1401
Illegal SapI.rc site found at 5998
Design Notes
N/A
Source
P. plebeius genome
Primers for cloning: FW: cttttaataatataaatatatgaacttcagatataaaacaatagtattcag (+ desired overhangs) RV: ttattttctcactttcttatcgtagcgt (+ desired overhangs)